Indie game storeFree gamesFun gamesHorror games
Game developmentAssetsComics
SalesBundles
Jobs

Share your levels in this community! Sticky

A topic by adriendittrick created Oct 03, 2021 Views: 395 Replies: 49
Viewing posts 1 to 29
Developer (1 edit)

Just copypaste the text of your levels in this thread or create your own thread containing all of your levels!

Developer (2 edits)

Here is a boring level:

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BB000000000000000000000000000BB B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00Y00000000000000000000000W00B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B B00000000000000000000000000000B BB000000000000000000000000000BB BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

X000000000000000000000000000000000000000000000000000000DDDDD0000000000000N00000000N000D00WD00000000000000000000000000D0DDD000000000000000000G000DDDDD0D000000000000000000000000D00000D000000000000G00000000000DFDDDDD000000000000000000N0000000D000000000Y00000000000000000000000000000000000000000000000000000000000000000000N0000000000000000000000000000000000000000N0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000X00000000000X000000000000000000


Good luck

Developer

This one feels unwinnable to me X)

removed*

Developer

ballistic kings:

00000000000000000000000000BBBB000000000000000000000000000IKBB000000000000000000000000000BBBB00000000000000000000BBB00BBB0000000000000I0V0000000IKB00IKB0BBB0000000000000000000BBB00BBB0IKB0000000000000000000000000000BBB00BBB0000000000000000000000BBB000IKBY000000000000000000000IWB000BBB00000000000000000BBB00BBB00000000000000000000000IKB0000000000000000000000000BB0BBB000000000000000000000BBBIKB0000BBB00000000000BBB0000IKBBBB0000IKB00000000000IKB0000BBB0000B00BBB00000000000BBB00000BBBBIKB000000000000000000000000BIKBBBB00000000

WW3

aaaaaaaaaaawwwwwwwsssssssssooooooooommmmmmmeeeeeeeeeee

Developer (1 edit)

Jump away (original idea by Fabo):

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX0000Y000IJ0J0J0JKJ0J0J0J0J0W0XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XX00000000000000000000000000000XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX

Developer

All the alphabet is here:

WAAAA000CC0000000000EE00F000000000000000CCC000D00000EE00FF00000000BBB00000000DD00000E000FF000G000000000000000D00000EE000F0000G0H0000I00000000DD0E00E000F0000G00H0000I00JJ00K0D00000NN000000GG00HH000I00JJ0KK0LL0M00NNN00000G000HH00II00JJ0KK0L0M0000N00000000000H00I000J00K0L00M00000000OO000000000000000K0L00MM00000000O00P000Q0RR00SS00T000U00V0000000O0PP00QQ0RR00SS00T00UU00V0000000000P00QQ0RR00S00TTT0U00VV000W00000X0000000000000000000000000WW000XX00000000000000Y00ZZ000000WW000XX00000000000000000ZZ000000000000000000000000000000000

  1. 00000000000000000000000000000000000000000000000000000000000000000000M000000O000000000BBBB000000000000000000000O0000G1MZB00000000M0000M000000000000OBBBB00000000000000000000B000M000000000000000000000000000000MMMMMM000000000000000000000000000MM0000000000000000Y000000000000000000000000000000000000000BBBBBBBBBBBBB000000000000000000IIIIIIIIIIIWB000000000000000000BBBBBBBBBBBBB00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

smash yourself

00000000000000000000000000000000000000000000000000000000000000000000000000000000000BBBBBBB0000BBBBBBB00000000000BBBBBBBBBBB00B00000B00000000BBBB0000B0000BB0B0BBB0BBB00000BB0000BBPBPBB00B0B0BBB000BB000BB00BBBBB0B0BBB0B0B0BBBBB00BBBBB00BBXXBB0B000B0B0B0BBKLBB0000000BBX0XB00B0DOB0B0B0BBBB0BBBBBBBBBX00XB00BD00B0BBB0BBBY0000X0X00X000XB00BBBBB0BBM00BBPBBBBBBBBBBBBBBBB0BWBB00BBVB0BB0P0000000000000BBPBBBB0BBBZB0BB0BBBBBBBBBBBB0BBB0B0000B0BVB0BBBBBBBBBBBBBBBDB0B000BBBB0BLB00000000000000000B0K0BBBB000BBBBBBBBBBBBBBBBBBBBBBBBB000000

(2 edits)

Sneaky Snake            Difficulty : easy

0000000000000000000000000000000000000000000000MMM00000000000000000TT000000000MSM000000MMM00000000TT000000000MMM000000MMM00000000TT00MMM0TTTT0000TT00MMMS0000000TT00MMM0TTTT0000TT00MMMS00000000000MMM000000000TT00MMM0000000000000000000MMM00TT000000000SMMMY00TTTTT00MMSMM0TT0000W00000000000TTTTT000MMM00TT00000000000000000000000000000TT00MMM000000000000MMM000000000TT00MMMS0000000TT00MMM0TTTT0000TT00MMMS0000000TT00MMM0TTTTMM00TT00MMM00000000TT000000000MSM000000MMM00000000TT000000000MMM00000000000000000000000000000000000000000000

(3 edits)

DNA               Difficulty : hard

GGCATAATCATGTCATCACGGAAGTAGCCGTAGATGTCGTTTTGCTAGTTTACGTCAAGGTGAGGTGGGCCGACGAGACATTATCCCTGATTTCACGGCGCAATACCAGCACAGCCTAGTCTCGACGAAAGAGCTTAAGGCAGGCCAATTCGCACTTTAGCACTACCGACAGGTACGCTAGTATGCTGTGGCCGCGTGGTCAAAAGTGCGGCTTTCGCTCTCACAAACTTGACCTGCACGCCAAAGAGYCAACGCAACAACGCGACGGATCTACGTWACGAGTTGCTGACGACGAAAGCGACATTGGGATAAAAACATCCGTCCCCGAGGCGGACACTGATGTTAGGGGATTAGGTTAGATTGAGTGGCTTATATAGTGTAGTAATCTCTGATTAACGGTGACGCAAAATCAAGCGGGGTCATTTCAACAGATAACAATGCCCTGAAGAATAATTAAGAAAAAAGTTACCTACCGCGGTCCACCATACCTTCGATTTAGTCGGCAGAGGTGGTTGTGTTGCGATAGC

Alright I gave making one a shot, here is some dynamiting

000000000000B00B00B00000000000 0000000BBBBB0BB0BB0BBBBB000000 0000000B   BDBBDBBDB   B000000 0000000B  0BBBBBBBBB000B000000 0000000B0BBQDQQDQQDQ  0B000000 0000   B0B B BB0BB0B   B   000 0000  BB BBBBBBBBBBBB  B00 000 0000  BM B  J00J00J0B  B 0 000 000000BMYO0000000000B WB00 000 000000BM0B0000000000B0 B   000 000000BBBB00000 0000BBBB000000 000000000000000000000000000000 000000000000000000000000000000 000000000000000000000000000000 000000000000000000000000000000 000000000000000000000000000000 00000000000000000000000000000

Developer

I did it :)

Ah sweet! 

some sort of alcohols(miswritten) scrabble i guess:

000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000BBBBBBBBBBBBB00000000000000000B0000V000000B00000000000000000B000PORTO000B00000000000000000B00K0D000000B00000000000000000BWHISKY00000B00000000000000000B00R0ALCOOLSB00000000000000000BBBBBBBBBBBBB00000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

Developer

I win!

HOW

(3 edits)

Normal day of being late for school in America:

...BBB.............BBBB........
..BBBBB...........BH1GHB.......
.BBDADBB.......BBBSCHOOLBBBBB..
BB.BED.BB.....B...........B..B.
.B.MOM.B......B....BBBB...B..B.
.BBBBBHB......B.K.........H..B.
.H.....B......B.BB........B..B.
.H....YB......B...........B..B.
.BBBBBBB......B.B.B.B.B.B.B..B.
..............B.Z.Z.Z.Z.Z.B..B.
..............B.B.B.B.B.B.B..B.
..............B.Z.Z.Z.Z.Z.B..B.
..............B.B.B.B.B.B.B..B.
..............B.Z.Z.Z.Z.Z.B..B.
..............B.B.B.B.B.B.B...B
BUS...........BWORK.Z.Z.Z.BOUTB
..............BBBBBBBBBBBBB.B.B

There are three bad endings and two ways to "win".
EDIT: No actually, I realized you can do weirder stuff.
Please post your stories in the replies :P

Developer (1 edit) (+1)

my mom killed my dad, and then a school shooter zombie ztole the only gun available.
When I restarted, I turned into a zombie but this time I had the gun so I killed half the other zombies.
Great level! After my third try I won

the students being zombies and gun in school are accurate

(1 edit)

"Real Estate" (Outdated and Unbeatable):
00000000000000BBBB000000000000000000000000000B MB000000000000000000000000000B00B000000000000000000000000000BO0B00000000000000000000000000BB00BB 000000000000000000000000BBDDBB0000000000000BBBBBBBBBBBBBB  BBBBBBBBBBBBBB0B0000000000000HHD00020B0000 WB0B000 0000Y0000HHD000B200000 WB0BBBBBBBBBBBBBBVVBBBBBBBBBBBBBB0000000000000BBDDBB0000000000000000000000000BB00BB00000000000000000000000000B00B00000000000000000000000000 BGGB 0000000000000000000000000 BGGB 0000000000000000000000000 B  B 00000000000000000000000000BBBB0000000000000

removed

Yo, calm yourself, the level is broken and doesn't work anymore because a bug got fixed which makes it unbeatable

Multi Missiles 2:
0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000MOM 000000000000000000000000000000000000000000000000000000000000000000 0000000000000000000YOU000000BBBBBBBBBBB0000000000000000000IIIIIIIWOWB0000000000000000000BBBBBBBBBBB000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

I WIN but i take a moment to figure it out.

A level where I obliged me to force the player to use 3 times the same "V" but it accidentally turn into a cat (or mouse idk).

0000000BBBBBB0BBBBBB0BBBBBBBBBB0000000B0G0GB0BG0G0B0000000000B0000000BGBBVB0BVBBGBBBBBBBBBB0B00SO000B0B0GBOBG0B0B000000B000B0000000BGBGBBWBB0BGB000000B0BBB0000000B0G0BBBBB0G0B000000B000B0CLOSE0BBBPGGYGGPBBBBBBBBBBBB0B000000000B0BBVBB0BBBBBBBBBBBB0B000000000B0BE0EB0B000000000000B000000000B0BBGBB0B0BVBVBVBVBVBB000000000B0BB5000B0BZBZBZBZBZB0000000000B0006BBBB0BVBVBVBVBVB0000000000BBBB700000BLBLBLBLBLB0000000000000BBBBBBBBBBBBBBBBBB00000000000000000000000000000000000000000CAT0OR0MOUSE00000000000000000000000000000000000000000

The fun zone :)
00000000000000000000000000000000000000000000000000000000M00000TTT 00000000000000000000000000TGTTHE0000000000E0000000000000TTT 00000000000000000BBB0000000 000000FUN00Z0000000BWB0000000000000000000 O000000B1B000000000000Y000000  N0000000000000000 00E0000000   E000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000O0O000000FFF0000000000000000000U0000000FFF000000000000000000000000000FFF00000000000000000000000000

Logic gates (not perfect) (if you found better logic gates please tell me):

00OR00000NO00000000000000000000000000000000000000000000000000000BBB000000B000000000000000000001Y00B0000BBB0000THE000IF00000000BB0MO005YDBB0000000000000000002Y00B000BYJB0000NO0000SOMEONE000BBB0000BBBBB0000000000000000000000000000000000ONLY00FOUND00000BBB0000BBB000000000000000000003YL0B006YGGBB000WORK00BETTER0000BB00O00BBG050000000000000000004YL0B007YGGBB000ON0000REPLY00000BBB0000BBBB00000000000000000000000000000000000INPUT0000000000AND00000XOR00000000000000000000000000000000000000000000000000000000000000000000000000000000

Developer

oh wow thats clever

Full 4 bits adder with the first 4 bits number under the 6, the second under the 7, the result above the 9. (only counting violet y when you have the maximum of them and when they're all above a 9).

This is preconfigured with 1111+0001 witch give 10000 witch is why the W is there. This system work for any numbers but you can get stuck if you're dumb.

Don't forget to move the W if you want to test others numbers. Feel free to try making a full 5 bits adder.

00B6B7BB6B7BB6B7BB6B7BBBBBBBBBB00BYB0BBYB0BBYB0BBYBY50000000VB00BGBGBBGBGBBGBGBBGBGBBBBBBBB0B00BGGG4BGGG4BGGG4BGGGVO0000VB0B000BVBL0BVBL0BVBL0BBBL0BBBB0B0B000BL0B0BL0B0BL0B0000BB00010B0B0000BOB00BOB00BO0BBB0000BOB0B0B0000B00B0B00B00B0000BBBBB0B0B0B00000B0O00B00B00BBB000000VB0B0BFULL0B00B00B00B0000BBBBBB0B0B0B000000B00B00B00BBB00000010B0B0B40BITS0B00B00B0000BBBBBOB0B0B0B00000000B00B00BBB000000VB0B0B0BADDER0000B00B0000BBBBBB0B0B0B0B0000000000B00BBB00000010B0B0BVB00000000000B000WBBBBBBB0B0B0B0B000000000000BBB9BBBBBBB9B9B9B9B

Developer

that works 0.o

ZNNNNNNNNNNNNNNNNNNNNNNNNNNNNNZNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN00000N00000N00000N00000NNNNNNN000000N00000N00000N000000NNNNNN000000000000N000000000000NNNNNN000000000000B000000000000NNNNNN000000000000B000000000000NNNNNNNNN000Y0000NBN0000W000NNNNNNNNN000000000000B000000000000NNNNNN000000000000B000000000000NNNNNN000000000000N000000000000NNNNNN000000N00000N00000N000000NNNNNNN00000N00000N00000N00000NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNZNNNNNNNNNNNNNNNNNNNNNNNNNNNNNZ

DON'T RUN JUST STAND WHERE YOU ARE YOU'LL BE SAFE

Developer(+1)

very good particle effects X)

i feel like i am melting from heat

0YYYYYYYYYYYYYBYBYYYYYYYYYYYYY00PPPPPPPPPPPPPB0BPPPPPPPPPPPPP00LLLLLLLLLLLLLB0BLLLLLLLLLLLLL000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B0000000000000000000000000000B0B00000000000000VVVVVVVVVVVVVVB0BVVVVVVVVVVVVVVBLLLLLLLLLLLLLB0BLLLLLLLLLLLLLBBWPPPPPPPPPPPPBNBPPPPPPPPPPPPWBBWAAAAAAAAAAAABNBAAAAAAAAAAAAWB0BBBBBBBBBBBBBBQBBBBBBBBBBBBBB0

WAR

BPL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000Y0000W000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000APL0000000000000000000000000000BPL0000000000000000000000000000

It IS possible

XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXYGGGGGGGGGGGGGGGGGGGGGGGGGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGXXGGGGGGGGGGGGGGGGGGGGGGGGGGGGGXXGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGGGGGGGGGGGGGGGGGGGGGGGGGGGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGXXGGGGGGGGGGGGGGGGGGGGGGGGGGGGGXXGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGGGGGGGGGGGGGGGGGGGGGGGGGGGGGXBBBBBXXXXXXXXXXXXXXXXXXXXXXXXGXBW99BGGGGGGGGGGGGGGGGGGGGGGGGGXBBB9BGXXXXXXXXXXXXXXXXXXXXXXXXXB999BGGGGGGGGGGGGGGGGGGGGGGGGGXB9BBBXXXXXXXXXXXXXXXXXXXXXXXXGXB999HGGGGGGGGGGGGGGGGGGGGGGGGGXBBBBBXXXXXXXXXXXXXXXXXXXXXXXXXX

Try to not be mad (Ants Are For You) Part 2 In The Makings

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBGG6GGGGG4GGG2GY1GG3GGGG5GGGGGBBGBBBBBBBBBBBBBBBBBBBBBBBBBBBGBBGBVVVVVVVVVVVVVVVVVVVVVVVVVB7BBGBMMMMMMMMMMMMMMMMMMMMMMMMMBGBBGBMMMMMMMMMMMMMMMMMMMMMMMMMBGBBGBMMMMMMMMMMMMQMMMMMMMMMMMMBGBB8BMMMMMMMMMMMMAMMMMMMMMMMMMBGBBGBMMMMMMMMMMMMMMMMMMMMMMMMMBGBBGBMMMMMMMMMMMMMMMMMMMMMMMMMBGBBGBOOOOOOOOOOOOOOOOOOOOOOOOOBGBBGB                         BGBBGBBBBBBBBBBBBBBBBBBBBBBBBBBB9BBGBW9GGGGGGGG7GGGGGG5GGGG3GG1 BBGBBBBBBBBBBBBBBBBBBBBBBBBBBB BBGGBGGGGGG8GGGGGGG6GGGGG4GGG2GBBBBBGGGGBBBBBBBBBBBBBBBBBBBBBBB

There are two endings here

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBNOP2W000ZZZZZ000000000000BP2WBBBBBBBBBBBBBBBBBBBBBBBBBB0BBB9BBZB000B00ZB00ZB00ZB0Z0B0B000B9BB0B0B0B0B0B0B0B0B0B0B0B0BBBZB9BB000B00ZB00ZB00ZB00ZB Z0Z00ZB9BB0BBBBBBBBBBBBBBBBBBBBBBBBBBB9BB0B0000  0000000000000000UBYB9BBBB BBBBBBBBBBBBBBBBBBBBBBB0B9BBJB0B  00    000000000000000B9BBLB0B0BBBBBBBBBBBBBBBBBBBBBBB9BBBB0B0BGGGGGGGGGGGGGGGGGGGGGB9BBJB0B0BGGGGGGGGGGGGGGGGGGGGGB9BB0B0 0BGGGGGGGGGGGGGGGGGGGGGB1BB0BBBBBGGGGGGGGGGGGGGGGGGBBBBGBBU   JBGGGGGGGGGGGGGGGGGG 0JB0BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBYYYLB0EBBBBBBBBBBBBBBBBBBBBBBBBYYYL000B0EBBBBBBBBBBBBBBBBBBBBBYYYL000000B0EBBBBBBBBBBBBBBBBBBYYYL000000000B0EBBBBBBBBBBBBBBBYYYL000000 00000B0EBBBBBBBBBBBBYYYL000000 00000000B EBBBBBBBBBYYYL000000 00000000000B0EBBBBBBYYYL 00000 00000000000000000WBBYYYL000000 00000000000B0EBBBBBBYYYL000000 00000000B EBBBBBBBBBYYYL000000000000B0EBBBBBBBBBBBBYYYL000000000B0EBBBBBBBBBBBBBBBYYYL000000B0EBBBBBBBBBBBBBBBBBBYYYL000B0EBBBBBBBBBBBBBBBBBBBBBYYYLB0EBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

i kinda modifyed ur level


BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB0000B0EBBBBBBBBBBBBBBBBBBBBBBBB0000000B0EBBBBBBBBBBBBBBBBBBBBB0000000000B0EBBBBBBBBBBBBBBBBBB0000000000000B0EBBBBBBBBBBBBBBB0000000000 00000B0EBBBBBBBBBBBB0000000000 00000000B EBBBBBBBBB0000000000 00000000000B0EBBBBBB00YL000000 00000000000000000WBB0000000000 00000000000B0EBBBBBB0000000000 00000000B EBBBBBBBBB0000000000000000B0EBBBBBBBBBBBB0000000000000B0EBBBBBBBBBBBBBBB0000000000B0EBBBBBBBBBBBBBBBBBB0000000B0EBBBBBBBBBBBBBBBBBBBBB0000B0EBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

eh it's supposed to have alot of players but eh

ik but then it gets hard to controll them all and then one could shoot at another so it may be better like this

here is my level lol


0000000000000000BFFFFF0000FFFFF0000000000000000BF000F0000F000F00G0000000000000BF000F0000F000F000G000000000000BF000F0000F000FR000G00000000000BF000FFFFFF000F00000G0000000000BF000000000000F000000G000000000BF000000000000F0000000G00000000BF000000000000F00000000G0000999BF000FFFFFF000F000000000G009000BF000F000FF000F0000000000G09000BF000F0000F000FR0000YL00000900UBF0U0F0000F0W0FBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000

cool level lol

000ÒÒ000 0000000000000000000000ÒÒÒÒÒ000 00  000000000000000000ÒÒÒÒÒ000     000000000000000000ÒÒÒÒÒ000     000000000000000000ÒÒÒÒÒ000     000000000000000000ÒÒÒÒÒ000     0000000000000BBBB0ÒÒÒ000000    BBBBBBBBBBBBBB00BBÒBBBBBBBBBBBBBXXXXXXXXXXXXBP00BÒBYÒ000       GGGGGGGGGGGG000UBÒBBBBBBBBBBBBBXXXXXXXXXXXXBBBBBÒÒÒ000000 000BBBBBBBBBBBBBB0000ÒÒÒÒÒ000000 0000000000000000000ÒÒÒÒÒ00000000000000000000000000ÒBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBÒBÒÒÒ00000000Z00000000Z000006WBÒBUL0000Z00000000Z00000000006WBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

a level lol


BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB000B000B000B000B000B000B00000BBYM0O0M0O0M0O0M0O0M0O0M0O00M00BB000B000B000B000B000B000B00000BBBBBBBBBBBBBBBBBBBBBBBBBBBBBOBBB000B000B000B000B000B000B00000BB0M0O0M0O0M0O0M0O0M0O0M0O00M00BB000B000B000B000B000B000B00000BBBOBBBBBBBBBBBBBBBBBBBBBBBBBBBBB000B000B000B000B000B000B00000BB0M0O0M0O0M0O0M0O0M0O0M0O00M00BB000B000B000B000B000B000B00000BBBBBBBBBBBBBBBBBBBBBBBBBBBBBOBBB000B000B000B000B000B000B00000BB0W0O0M0O0M0O0M0O0M0O0M0O00M00BB000B000B000B000B000B000B00000BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB