I'm relieved to hear it !
(you don't know how many people suffered in the testing phase ...)

If you need a Game Maker Studio dev, welp I'm here !

... excuse me ???

No you can't sadly. You can encrypt it then decrypt it in GMS.
But don't forget, everything in GMS can be modified (sprites, rooms, code, ...) unless you compile your game with the YYC

Sorry but the asset already needs a lot of rework. In future updates it will be easier to grab data and make it whatever you want like JSON export. However you should be aware GMS2 and Web have a lot of problems and doesn't really provide saving files

Sadly sprites data and other important datas are chosen with a random seed hack. The entire asset will be remade from scratch (Structs as data, better point placement, ...)
However it won't be updated until the end of January due to upcoming exams :(. My apologies and thank you for your interest in the asset.

Really fresh rogue light, made my evening and will for the next ones

Simple gameplay with charming graphics. Short yet amazing and rhythmic music. A really nice game that make you want more ! :P

Game is playable for everyone now :) enjoy !

I see you're also into Generative Art ;)    (https://openprocessing.org/user/266498)
As it was a LUA tutorial that I was asked to remake for GMS I didn't dive into it too much. Definitely Poisson-Disc or even a simple random dot placement with constrains would have been faster. Thanks for your interest in the project otherwise :) <3

Actually I was expecting and hoping for it >:)

See you for on the future update <3 <3 <3

Only my Giftee (for the Santa Jam) knows the password.
It will be removed once the game is 100% finished :)

Really cute and simple game <3

DNA               Difficulty : hard

GGCATAATCATGTCATCACGGAAGTAGCCGTAGATGTCGTTTTGCTAGTTTACGTCAAGGTGAGGTGGGCCGACGAGACATTATCCCTGATTTCACGGCGCAATACCAGCACAGCCTAGTCTCGACGAAAGAGCTTAAGGCAGGCCAATTCGCACTTTAGCACTACCGACAGGTACGCTAGTATGCTGTGGCCGCGTGGTCAAAAGTGCGGCTTTCGCTCTCACAAACTTGACCTGCACGCCAAAGAGYCAACGCAACAACGCGACGGATCTACGTWACGAGTTGCTGACGACGAAAGCGACATTGGGATAAAAACATCCGTCCCCGAGGCGGACACTGATGTTAGGGGATTAGGTTAGATTGAGTGGCTTATATAGTGTAGTAATCTCTGATTAACGGTGACGCAAAATCAAGCGGGGTCATTTCAACAGATAACAATGCCCTGAAGAATAATTAAGAAAAAAGTTACCTACCGCGGTCCACCATACCTTCGATTTAGTCGGCAGAGGTGGTTGTGTTGCGATAGC

Sneaky Snake            Difficulty : easy

0000000000000000000000000000000000000000000000MMM00000000000000000TT000000000MSM000000MMM00000000TT000000000MMM000000MMM00000000TT00MMM0TTTT0000TT00MMMS0000000TT00MMM0TTTT0000TT00MMMS00000000000MMM000000000TT00MMM0000000000000000000MMM00TT000000000SMMMY00TTTTT00MMSMM0TT0000W00000000000TTTTT000MMM00TT00000000000000000000000000000TT00MMM000000000000MMM000000000TT00MMMS0000000TT00MMM0TTTT0000TT00MMMS0000000TT00MMM0TTTTMM00TT00MMM00000000TT000000000MSM000000MMM00000000TT000000000MMM00000000000000000000000000000000000000000000

C'est super cool que tu continu le projet !
On restait vraiment sur notre faim mais avec plus de quêtes et un plus grand terrain de jeu on replonge dans ce super univers sans problème !
Par contre pour les contrôles de la voiture tu n'as pas cédé xD

11/10 small game !
The one and only problem I could find is the lack of feedbacks when you are hit else it's really fun to play and we feel every hit in the balls !

Short n' sweet game. Amazing sound atmosphere and story. A really fun game to play. Nice black mustang by the way ;)

Even better with graphics B)

not like superman tho :(

scary af, wouldn't recommend to any of my friends to keep them alive :)

oh thank you !!!
Didn't expect people to watch my tutorial ^^
The AI is not mine so I can't really help. It sometimes doesn't work for some difficulty levels and some songs
Try different difficulties but if nothing works you can try different AIs like one of my friend's choice AutoStepper
I don't really know much about how it works so good luck :)

Have fun making amazing rhythm games and don't be shy sharing it with me (@DevShynif on Twitter, Shynif#4685 on Discord) !

10/10 would recommend to all my sadomasochist friends

fun mechanic

Great game but the replay is hard, it takes too much time for some endings. Also, some easy "narrative knot paths" aren't use like the button, nothing happens when you just don't press it and wait.
But there is a plant 11/10 would recommend to all my friends.

Oh yes thank you !!!
I forgot the link to the song !
here you go, enjoy <3

thank you ! <3

when you click left or right there is a delay when you can press again
so you would do Left (registers) / Right too quick (doesn't register) / Left (registers) / ...
and that would mess everything.

Maybe it comes from my Browser (Opera)
Good luck to find the bug and thank you for your reply

Amazing atmosphere and excellent fishing game.

But there are some downsides, the tutorial is too long
and even annoying when you just want to fish.
And the Left-Right mouse click system is great but it's buggy as hell by not registering well the inputs...
Please fix it.
(and maybe show which '?' zone we have to click)

I would love to play this game again !
Keep the great work !

Good small game but god it needs more feedbacks

on va dire que jouer c'est cool

Mais la speed à 20 et un vieux palette_x = lerp(palette_x, balle_x, 0.4);

Là ça déchire B)

thank you so much !
I'm glad it helped someone <3

thanks
I guess ?

I had to stop at 232 but it's a great game !

Amazing and funny game !
It's amazing how big it grows for the Obelisk

Nom du Jeu <3

Amazing, short and sweet game !
A really nice demake ! 

Excellent game ! It changed and improved a lot since the fist version.
It deserves ti be played !
(and I don't say that because I have 3 world records ;) )

Can't wait for the full length game version !